FAM200C

Family with Member 200 C is a protein, which in humans is encoded by the FAM200C gene. The primary aliases of the gene are ZBED8, C5orf54, and Buster3.

Gene

In the human genome, FAM200C is located on the minus strand of chromosome 5, at 5q33.3. FAM200C can be transcribed into 2 different transcript variants, which contain 3 and 2 exons, respectively.

Expression

FAM200C is expressed ubiquitously and variably in human tissues, with a 10-fold difference between the lowest and highest expression values. FAM200C has the highest tissue expression in the ovaries, followed by the endometrium, thyroid, testis, and prostate.

mRNA

FAM200C mRNA has 2 transcript variants. FAM200C Variant 1 is the longest in terms of nucleotide length, spanning 2,882 nucleotides.

Transcript Variant	Variant Length	Accession Number	Protein	Protein Length
FAM200C Variant 1	2,882			594
FAM200C Variant 2	2,808			594

Protein

The Family with Sequence Similarity 200 Member C protein in Homo sapiens is encoded by the FAM200C gene. Protein FAM200C has a predicted molecular weight of 68326.71 Da, with a theoretical isoelectric point of 5.98. The protein is localized to the Nucleoplasm.

Promoter

Using UCSC's Genome Browser, a promoter region sequence was found. The most likely promoter region for FAM200C starts at 160,399,954 and goes to 160,400,554, with a length of 601 base pairs.

Structure

Secondary structure

The figure "FAM200C Predicted Secondary Structure" 1 and 2 provide a Phyre2.2 model prediction of FAM200C's secondary structure. Model indicates secondary structure is predicted to be composed of 9% disordered, 45% alpha helices, and 8% beta strands.

Tertiary structure

FAM200C tertiary structure predictions available through Phyre2.2 and AlphaFold.

Gene ontology

The figure titled "FAM200C Mature miRNA Sequences by Target Score" shows the 8 mature miRNA sequences for FAM200C available through text mining.

miRNA Name	Target Score	Seed Location	miRNA Sequence
hsa-miR-767-5p	76	291	UGCACCAUGGUUGUCUGAGCAUG
hsa-miR-627-3p	73	171, 321	UCUUUUCUUUGAGACUCACU
hsa-miR-550a-3p	70	454	UGUCUUACUCCCUCAGGCACAU
hsa-miR-4524a-3p	65	64	UGAGACAGGCUUAUGCUGCUAU
hsa-miR-942-5p	62	326	UCUUCUCUGUUUUGGCCAUGUG
hsa-miR-449c-5p	60	188	UAGGCAGUGUAUUGCUAGCGGCUGU
hsa-miR-34b-5p	60	188	UAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-376c-3p	60	95	AACAUAGAGGAAAUUCCACGU

Evolutionary history

FAM200C first arose around 94 million years ago. FAM200C is part of the Ribonuclease H-like superfamily. A Swedish University for Agricultural Sciences research team led by Dr.Alexander Hayward and Dr.Awaisa Ghazal, studying the evolutionary origins of the ZBED genes published a paper in PLOS one, reporting that: "ZBED proteins, such as C5ORF54, or ZBED8, originated from domesticated hAT DNA transposons and encode regulatory proteins with diverse, fundamental functions in vertebrates."

Orthologs

FAM200C orthologs were found exclusively in mammals. The most distantly related ortholog, Talpa occidentalis, has two transcript variants.

Taxonomic Class	Taxonomic Order	Genus and Species	Common Name	Date of Divergence	Accession Number	Sequence Length	Sequence Identity	Sequence Similarity
Mammalia	Primates	Homo sapiens	Human	0	NP_001290180.1	594	100	100
Mammalia	Primates	Gorilla gorilla gorilla	Gorilla	8.6	XP_004042980.2	594	99	100
Mammalia	Primates	Macaca nemestrina	Pig-tailed macaque	28.8	XP_001084430.1	593	98	99
Mammalia	Primates	Trachypithecus francoisi	Francois' langur	28.8	XP_033036286.1	593	98	99
Mammalia	Primates	Cebus imitator	Panamanian white-faced capuchin	43	XP_017357604.1	594	97	100
Mammalia	Primates	Saimiri boliviensis	Bolivian squirrel monkey	43	XP_074246649.1	633	97	100
Mammalia	Primates	Otolemur garnettii	Small-eared gelago	74	XP_012664265.1	594	94	100
Mammalia	Artiodactyla	Camelus dromedarius	Arabian camel	94	XP_010991120.3	594	94	100
Mammalia	Perissodactyla	Equus quagga	Plains zebra	94	XP_046524538.1	641	94	100
Mammalia	Carnivora	Leopardus geoffroyi	Geoffroy's cat	94	XP_045358866.1	594	94	100
Mammalia	Carnivora	Mirounga leonina	Southern elephant seal	94	XP_034869533.1	594	94	100
Mammalia	Carnivora	Zalophus californianus	California sea lion	94	XP_027462964.1	639	94	100
Mammalia	Carnivora	Vulpes lagopus	Arctic fox	94	XP_041602806.1	593	94	100
Mammalia	Carnivora	Neogale vison	American mink	94	XP_044086173.1	594	93	100
Mammalia	Carnivora	Mustela lutreola	European mink	94	XP_059030193.1	549	93	100
Mammalia	Chiroptera	Pteronotus mesoamericanus	Pteronotus parnellii mesoamericanus	94	XP_054423860.1	594	93	100
Mammalia	Chiroptera	Molossus molossus	Pallas' mastiff bat	94	XP_036098001.1	594	92	100
Mammalia	Eulipotypha	Talpa occidentalis	Iberian mole	94	XP_036098001.1	594	92	100

Paralogs

FAM200C has 18 paralogs. Based on target % identity to FAM200C, the three most significant paralogs are FAM200A, FAM200B, and ZBED5.

Name	Full Name	Target % Identity	Sequence Length	Accession Number	Location
FAM200A	Family with Sequence Similarity 200 Member A	29.49	573	ENSG00000221909	7:99,546,300-99,559,392:-1
FAM200B	Family with Sequence Similarity 200 Member B	29.70	657	ENSG00000237765	4:15,681,506-15,690,447:1
ZBED5	Zinc Finger BED-type Containing 5	27.13	693	ENSG00000236287	11:10,812,074-10,858,796:-1

Multiple sequence alignment

The figure titled "Snippet of FAM200C Orthologs Multiple Sequence Alignment" shows a snippet of the multiple sequence alignment for FAM200C orthologs. This snippet represents the conservation of FAM200C as most of the sequence is conserved.

Protein divergence

As shown in the figure titled "Informational context of ''FAM200C human protein...", the human FAM200C'' protein, is evolving slowly over time in comparison to both Fibrinogen Alpha and Cytochrome C.

Conceptual translation

The figure titled "Conceptual Translation for FAM200C" shows the conceptual translation of the human FAM200C transcript variant 1 showing exon boundaries, domains/motifs, polyadenylation sites, and phosphorylation sites, and a legend.

Single nucleotide polymorphisms

There are 3734 single nucleotide polymorphisms catalogued in NCBI's Variation Viewer, only one of which has a clinical significance record. The only clinically significant single nucleotide polymorphism found, rs61740683, is a synonymous, single nucleotide variant with benign clinical significance.

Clinical significance

FAM200C promoter could have a dual function as it starts transcription for the FAM200C gene and also an enhancer for the gene miR-146a. In a 2023 study published to the Arthritis and Rheumatology Journal for the American College of Rheumatology, researchers Xinyi Zhu, et al. discovered that when the FAM200C gene was knocked down, the expression levels for miR-146a were unaffected. This suggests that the promoter regions could also function as enhancers and regulate the expression of genes in close proximity. FAM200C is also a potential biomarker for Sarcoidosis. In a 2020 study published to the Medical Science Monitor, Min Zhao et al. identified FAM200C as a "SARC-only DEG". The researchers found that FAM200C is up-regulated in Sarcoidosis, meaning there is increased gene expression in patients with Sarcoidosis compared to patients with Pulmonary Tuberculosis and healthy control patients.